Product Image

Contributor Information

  • Name Duccio Conti ; Viji M. Draviam
  • Institute Queen Mary University of London

Tool Details

  • Tool name: HeLa FRT/TO (YFP-Astrin WT siRNA res) cell line
  • Alternate names: HeLa FRT/TO YFP-Astrin WT cell line conditionally expressing siRNA-resistant YFP-Astrin WT.
  • Tool type: Cell Lines
  • Tool sub-type: Continuous
  • Parental cell line: HeLa cell line
  • Organism: Human
  • Tissue: Cervix
  • Model: Cancer Model
  • Research area: Cancer; Cell biology; Cell signaling and signal transduction
  • Production details: HeLa FRT/TO YFP-Astrin WT cell line conditionally expressing siRNA-resistant YFP-Astrin WT. Created by transfection of HeLa Flp recombinase cell line with pCDNA5-FRT/TO-YFP-Astrin WT expression plasmid, followed by a brief Hygromycin selection and sorting for YFP positive using FACS.
  • Additional notes: siRNA oligos to target Astrin mRNA 5 UTR (GACUUGGUCUGAGACGUGAtt) or Astrin 52 oligo (UCCCGACAACUCACAGAGAAAUU).

  • For Research Use Only

Target Details

Application Details

  • Application notes: siRNA oligos to target Astrin mRNA 5â?‚€?‚™ UTR (GACUUGGUCUGAGACGUGAtt) or Astrin 52 oligo (UCCCGACAACUCACAGAGAAAUU).

Handling

  • Format: Frozen
  • Shipping conditions: Dry ice

Documentation

Related Tools

Product Image

C2.2.1 cell line

#161799
Product Image

PC346C 19 [RD B] CRPC Cell line

#161829
Product Image

PC339C Cell line

#161810

References

  • •  31808746