Product Image

Contributor Information

  • Name Duccio Conti ; Viji M. Draviam
  • Institute Queen Mary University of London

Tool Details

  • Tool name: HeLa FRT/TO (YFP-Astrin 4A siRNA res) cell line
  • Alternate names: HeLa FRT/TO YFP-Astrin WT cell line conditionally expressing siRNA-resistant YFP-Astrin WT.
  • Tool type: Cell Lines
  • Tool sub-type: Continuous
  • Parental cell line: HeLa cell line
  • Organism: Human
  • Tissue: Cervix
  • Model: Cancer Model
  • Research area: Cancer; Cell biology; Cell signaling and signal transduction
  • Production details: HeLa FRT/TO YFP-Astrin 4A cell line conditionally expressing siRNA-resistant YFP-Astrin 4A. Created by transfection of HeLa Flp recombinase cell line with pCDNA5-FRT/TO-YFP-Astrin 4A expression plasmid, followed by a brief Hygromycin selection and sorting for YFP positive using FACS.
  • Additional notes: siRNA oligos to target Astrin mRNA 5 UTR (GACUUGGUCUGAGACGUGAtt) or Astrin 52 oligo (UCCCGACAACUCACAGAGAAAUU). Astrin-4A mutant (RVMF to AAAA substitution) was generated using site directed mutagenesis.

  • For Research Use Only

Target Details

Application Details

  • Application notes: siRNA oligos to target Astrin mRNA 5â?‚€?‚™ UTR (GACUUGGUCUGAGACGUGAtt) or Astrin 52 oligo (UCCCGACAACUCACAGAGAAAUU). Astrin-4A mutant (RVMF to AAAA substitution) was generated using site directed mutagenesis.

Handling

  • Format: Frozen
  • Shipping conditions: Dry ice

Documentation

Related Tools

Product Image

BCH-RB42 Retinoblastoma cell line

#160616
Product Image

R-3327-AT-1 cell line

#156406
Product Image

HAK Clone 12 cell line

#154467

References

  • •  31808746