Product Image

Contributor Information

  • Name Duccio Conti ; Viji M. Draviam
  • Institute Queen Mary University of London

Tool Details

  • Tool name: HeLa FRT/TO (YFP-Astrin Delta70 siRNA res) cell line
  • Alternate names: HeLa FRT/TO YFP-Astrin WT cell line conditionally expressing siRNA-resistant YFP-Astrin WT.
  • Tool type: Cell Lines
  • Tool sub-type: Continuous
  • Parental cell line: HeLa cell line
  • Organism: Human
  • Tissue: Cervix
  • Model: Cancer Model
  • Research area: Cancer; Cell biology; Cell signaling and signal transduction
  • Production details: HeLa FRT/TO YFP-Astrin Î?‚”70 cell line conditionally expressing siRNA-resistant YFP-Astrin Î?‚”70. Created by transfection of HeLa Flp recombinase cell line with pCDNA5-FRT/TO-YFP-Astrin Î?‚”70 expression plasmid, followed by a brief Hygromycin selection and sorting for YFP positive using FACS.
  • Additional notes: siRNA oligos to target Astrin mRNA 5 UTR (GACUUGGUCUGAGACGUGAtt) or Astrin 52 oligo (UCCCGACAACUCACAGAGAAAUU). Astrain ?70 mutant was generated by PCR amplification of 11122 coding region of Astrin and subcloning into the desired expression vector.

  • For Research Use Only

Target Details

Application Details

  • Application notes: siRNA oligos to target Astrin mRNA 5â?‚€?‚™ UTR (GACUUGGUCUGAGACGUGAtt) or Astrin 52 oligo (UCCCGACAACUCACAGAGAAAUU). Astrain Î?‚”70 mutant was generated by PCR amplification of 1â?‚€?‚“1122 coding region of Astrin and subcloning into the desired expression vector.

Handling

  • Format: Frozen
  • Shipping conditions: Dry ice

Documentation

Related Tools

Product Image

NCI-HPN-F1G-Mam Cell Line

#161041
Product Image

Ruby-Mad2 Reporter Cell Line

#153466
Product Image

HeLa/EGFP_Cytochrome c

#161151

References

  • •  31808746