CELL LINES

Contributor Information
- Name Julian Downward
- Institute The Francis Crick Institute
Tool Details
- Tool name: CT26 TTPKO cell line
- Alternate names: TTP
- Tool type: Cell Lines
- Tool sub-type: Continuous
- Parental cell line: CT26 ATCC-CRL-2638
- Organism: Mouse
- Disease: Cancer
- Model: Knock-Out
- Conditional: No
- Description: CRISPR/Cas tristetraprolin (TTP) Knock-out KRAS mutant colon carcinoma cell line. In some immunoresistant tumours, PD-L1 expression is upregulated by RAS activation. Via the MEK pathway, the MK2 kinase phosporylates and inhibits TTP, which negatively regulates PD-L1 expression. PD-L1 is a therapeutic target to check the immune evasion mechanism of some cancers. CRISPR edited CT26 cells.
- Research area: Cancer; Cell Cycle; Cell Signaling & Signal Transduction
- Production details: CRISPR/Cas TTP Knock-out KRAS mutant colon carcinoma cell line.Knock Out of functional TTP was confirmed by Western blot. CompleteZfp36 allele disruption was confirmed by TOPO-TA cloning followed bysequencing.Mouse Zfp36 was targeted with gRNA sequenceGTCATGGCTCATCGACTGGAGG, using U6gRNA-Cas9-2A-GFP
- Additional notes: CRISPR edited CT26 cells. Cancer Research Technology Limited (trading research tools as Ximbio) has been granted a non-exclusive license to the CRISPR-Cas9 technology by ERS Genomics Ltd under the patent rights listed here. This license from ERS Genomics Ltd allows Ximbio to develop and commercialise CRISPR-Cas9 modified cell lines for research use only. Ximbio can provide these modified CRISPR-Cas9 cell lines to companies under a label-use only license.
- For Research Use Only
Target Details
- Target: Tristetraprolin (TTP)
Application Details
- Application notes: Cancer Research Technology Limited (trading research tools as CancerTools.org) has been granted a non-exclusive license to the CRISPR-Cas9 technology by ERS Genomics Ltd under the patent rights listed here: https://www.cancertools.org/tool-faqs#hs_cos_wrapper_widget_1649861453796 This license from ERS Genomics Ltd allows CancerTools.org to develop and commercialise CRISPR-Cas9 modified cell lines for research use only. CancerTools.org can provide these modified CRISPR-Cas9 cell lines to companies under a label-use only license
Handling
- Format: Frozen
- Growth medium: RPMI-1640 + 10% FCS. Subculture split ratio of 1:4 to 1:10 every 2-3 days.
- Storage conditions: Liquid Nitrogen
- Shipping conditions: Dry ice
- Mycoplasma free: Yes
- Biosafety level: 1
References
- • Coelho et al. 2017. Immunity. 47(6):1083-1099.e6. PMID: 29246442.